> 2) Read one entry, do something to the entry, then discard it and read
> in the next entry.

This is what I want to do. Read one entry, extract information from it, 
then read next entry. He says using an array will take up a lot of 
memory so he said use a buffer.


> But, you will end up reading every entry twice, which
> is stupid.  The easiest way to read in the file and prepare each entry
> is to set the input separator to "\n\n", then use each() to read in a
> paragraph, then use split("\n") to split each entry into lines, then add
> back a \n to the first line.
>
> Also, are you aware that this:
>
>>gi|456299107|ref|NM_2342343.3Acc2| Def2 zgc:65895 (zgc:65895), mRNA\n
> GTCGCTGGGTCGAAAAGTGGTGCTATATCGCGGCTCGCGTCGATGTCGCGATG <-- no "\n"
> CGTGCGCGCGAGAGCGCGCTATGATGAAAGGATGAGAGAG <-- no "\n"
>
> is equivalent to:
>
>>gi|456299107|ref|NM_2342343.3Acc2| Def2 zgc:65895 (zgc:65895), mRNA
> 
GTCGCTGGGTCGAAAAGTGGTGCTATATCGCGGCTCGCGTCGATGTCGCGATGCGTGCGCGCGAGAGCGCGCTATGATGAAAGGATGAGAGAG

Yes I am aware of that - I just put "no \n" for emphasis. Regarding the 
pos(), I think he said to use it as a guide to help with the detection 
of each ">" . Thanks for being patient and helping out.

-- 
Posted via http://www.ruby-forum.com/.