Thanks guys for your helpful comments. I will be more descriptive. I am 
an intern and my mentor wants me to use the IO.pos to read the 
characters of the file until the character reaches the ">" symbol. SO 
upon the cursor reaching the ">" symbol(which is the start of a new 
entry), he wants me to place that previous entry in a buffer. Here is 
the actual test file I am working with:

>gi|329295464|ref|NM_2005745.3Acc1| Def1 zgc:65895 (zgc:65895), mRNA\n
AGCTCGGGGGCTCTAGCGATTTAAGGAGCGATGCGATCGAGCTGACCGTCGCG\n
\n
>gi|456299107|ref|NM_2342343.3Acc2| Def2 zgc:65895 (zgc:65895), mRNA\n
GTCGCTGGGTCGAAAAGTGGTGCTATATCGCGGCTCGCGTCGATGTCGCGATG\n
CGTGCGCGCGAGAGCGCGCTATGATGAAAGGATGAGAGAG\n
\n
>gi|3542945647|ref|NM_7453343.5Acc3| Def3 zgc:65895 (zgc:65895), mRNA\n
CGTGCGGGGABCCGTACGTGCCGTGGGGGTTTAATAGCGCGCCATCTGAGCAG\n
TTAGTCGCTGACGCATGCACG\n
\n

7stud, you are right there are two consecutive newlines which I failed 
to mention. This should be the output of a buffer for one entry:

>gi|456299107|ref|NM_2342343.3Acc2| Def2 zgc:65895 (zgc:65895), mRNA\n
GTCGCTGGGTCGAAAAGTGGTGCTATATCGCGGCTCGCGTCGATGTCGCGATG <-- no "\n"
CGTGCGCGCGAGAGCGCGCTATGATGAAAGGATGAGAGAG <-- no "\n"


Notice how the newlines are gone. So with the exception of the header in 
each entry, the newlines should be gone and be placed in a buffer. I am 
lost on how to use the IO.pos and a file iterator to make sure each 
respective entry goes into a buffer without the file being indexed into 
memory.

Thanks in advance, I'm new to the language and trying to wrap my head 
around it.

-- 
Posted via http://www.ruby-forum.com/.